DNA/RNA Conversion







Select a file







Function:
Conversion between DNA sequences and RNA sequences.


Input:
Upload FASTA format sequences or paste the FASTA format sequences in the window.


Parameters:

None.


Output:

DNA or RNA sequences in FASTA format.

Input file: example (click to download)


Input RNA sequences (fasta format):


>cel-let-7 MIMAT0000001 Caenorhabditis elegans let-7
UGAGGUAGUAGGUUGUAUAGUU
>cel-lin-4 MIMAT0000002 Caenorhabditis elegans lin-4
UCCCUGAGACCUCAAGUGUGA
>cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1
UGGAAUGUAAAGAAGUAUGUA
    

The output, DNA sequence (fasta format):

>cel-let-7 MIMAT0000001 Caenorhabditis elegans let-7
TGAGGTAGTAGGTTGTATAGTT
>cel-lin-4 MIMAT0000002 Caenorhabditis elegans lin-4
TCCCTGAGACCTCAAGTGTGA
>cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1
TGGAATGTAAAGAAGTATGTA