BLAST-Two Sequences Alignment





1:



Upload a file
Select a file *


2:
Select a file *

*

* display the information of match level


*

  Email me when task completed.

 The number of coins consumed at one time is 1



Function:
Local alignment between two sequences.


Input:

Upload query sequences and subject sequences in FASTA format.


Parameters:

①E value:The default value is 10.

②Output format: Different output formats will provide different levels of details about alignment result.

③The introduction of different alignment programs is as follow:


Program Query Subject Function
blastn nucleotide sequence nucleotide sequence search nucleotide databases using a nucleotide query
blastp protein protein search protein databases using a protein query
blastx nucleotide sequence protein search protein databases using a translated nucleotide query
tblastn protein nucleotide sequence search translated nucleotide databases using a protein query
tblastx nucleotide sequence nucleotide sequence search translated nucleotide databases using a translated nucleotide query

Output:
The program provide 11 output formats for your selection.

Example:The original DNA sequence

>gi|397824|dbj|D17397.1|DOGCYP2D Canis lupus familiaris CYP2D mRNA for P-450 2D, complete cds
GAGCACCCTGGCTGGCCAGCCCCAGGTCCCTGGTGTGGTGAGGGACACCGGCGTGCCCCACGAGCCCAGC
GGGCACTGAGACAGCTATGGGGCTGCTGACCGGGGACACGCTGGGGCCCCTGGCCGTAGCCGTGGCCATC
TTCCTGCTCCTGGTAGACCTGATGCACCGGCGCAGGCGCTGGGCCACACGCTACCCGCCAGGCCCCACGC
CAGTGCCCATGGTGGGCAACCTGCTGCAGATGGACTTCCAGGAACCAATCTGCTACTTCAGCCAGCTGCA
AGGCCGCTTCGGAAACGTGTTCAGCCTGGAGCTGGCCTGGACGCCGGTGGTCGTGCTCAACGGCCTGGAG
GCGGTGCGCGAGGCCCTGGTGCACCGCAGCGAGGACACTGCCGACCGCCCACCTATGCCGATCTATGACC
ACCTGGGTTTGGGGCCAGAATCCCAAGGGTTGTTCCTGGCGCGCTACGGGCGCGCGTGGCGCGAGCAGCG
GCGCTTCTCGCTGTCCACCCTGCGCAACTTCGGCCTGGGCAGGAAGTCCCTGGAGCAGTGGGTGACCGAG
GAGGCCTCGTGCCTCTGCGCGGCCTTCGCCGAGCAGGCGGGCCGCCCCTTCGGCCCCGGCGCGCTGCTGA
ACAAGGCGGTGAGCAACGTGATCTCGTCGCTCACCTACGGGCGCCGCTTCGAGTACGACGACCCGCGGCT
GCTCCAGCTGCTGGAGCTCACCCAGCAGGCGCTGAAGCAGGACTCCGGCTTCCTGCGTGAGGCCCTGAAC
TCCATCCCCGTGCTCCTGCACATCCCGGGACTGGCCAGCAAGGTCTTCTCCGCGCAGAAGGCCATCATAA
CCCTGACAAATGAAATGATCCAGGAGCACAGGAAGACCCGGGACCCCACCCAGCCACCCCGACACCTGAT
CGACGCCTTCGTGGATGAGATAGAAAAAGCCAAAGGGAACCCCAAGACCAGCTTCAATGAGGAGAACCTG
TGCATGGTGACCTCTGACCTGTTCATCGCTGGGATGGTGTCCACCTCAATCACGCTGACCTGGGCCCTCC
TGCTCATGATCCTGCACCCGGACGTGCAGCGACGTGTCCAGCAGGAGATAGATGAGGTGATAGGGCGGGA
GCAGCTACCAGAGATGGGAGACCAGACCCGTATGCCCTTCACCGTGGCCGTGATCCATGAGGTGCAGCGT
TTTGGGGACATCGTCCCACTCGGTGTGCCCCACATGACGTCCCGAGACACTGAAGTGCAGGGCTTCCTCA
TCCCCAAGGGGACGACACTCATCACCAACCTGTCGTCAGTGCTAAAGGACGAGAAGGTCTGGAAGAAGCC
CTTCCGCTTCTACCCCGAGCACTTCCTGGACGCCCAGGGCCACTTCGTCAAGCATGAGGCCTTCATGCCC
TTCTCTGCAGGCCGCCGCGTCTGCCTCGGGGAGCCCCTGGCCCGCATGGAGCTCTTCCTCTTCTTCACCT
GCCTCCTGCAGCGCTTCAGCTTTTCAGTGCCTGCGGGGCAGCCCCGGCCCAGCGACCACGGGGTCTTCAC
CTTCCTGAAGGTTCCAGCCCCCTTCCAGCTCTGTGTGGAGCCTCGCTAGGGGCAGGAACCACCACCCCCC
GCCGCCCGGCTCCTCAGCAGGGGCCCGAGGTACAATAAACCAGTTTGGTGGCTCC

Select the target sequence:JX678711.1.fasta



The output information:
The blast results