Sequence Length Calculator






Select a file


  Email me when task completed.

 The number of coins consumed at one time is 1



Function:
Calculate and count the number of characters in a sequence.


Input:
The sequences of DNA/RNA/amino acid should be in FASTA format.


Parameters:

None.


Output:

Export a sequence length report

Example Test file (click to download):Statistical file sequence length

>EYKX4VC02EQLO5
TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
>EYKX4VC02D4GS2
AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA
    
Results of output:

EYKX4VC02EQLO5 108
EYKX4VC02D4GS2 60