MUSCLE-Multiple Sequences Alignment







Select a file


Output format: *


  Email me when task completed.

 The number of coins consumed at one time is 1



Function:
Multiple Sequences Alignment tools which achieve both better average accuracy and better speed than ClustalW.


Input:
Input sequences file should be in FASTA format.


Parameters:

None.


Output:
Five kinds of different output formats are provided, including fasta, html, msf, clw, clw-strict. The last two formats are according to the standard of program ClustalW.

Example:musclecmp Sequence alignment source files

Input DNA sequence (fasta format):

>gi|28422838|gb|CB252000.1|CB252000 2003_EST00001 Human HIV associated B-cell immunoblastic lymphoma Homo sapiens cDNA clone hss2-1-6-7, mRNA sequence
TGTGGTCTTCTTTCATTGACGCTCATCAGGGTGGGGAGTGATATATGTTGACTGGAGAGTCTAAAATACA
ACGGACCACTACAATCTCTCGGATATTCCACGTCGGT
>gi|28422842|gb|CB252002.1|CB252002 2003_EST00003 Human HIV associated B-cell immunoblastic lymphoma Homo sapiens cDNA clone hss2-2-9-5, mRNA sequence
CTGGTAGTCTTCGGGAGAGGCTTGAGAGTGTCTACTCACCCCTTCCCCTAAAAAAAAAAAAAAACTGGTT
GNCTCGGCCCTNACCCAGCTATCCAC
>gi|13779443|gb|BG644331.1|BG644331 EST00006 Human HIV associated B-cell centroblastic lymphoma Homo sapiens cDNA clone hss1-332 5' similar to B cell centroblastic lymphoma, HIV-associated, mRNA sequence
GACAGCGGCTGAGGAGGGGAAGAGAGTNCTAAATGATAACAGTCTTTATCCGTTAACGCTGAATAAATGC
CTTTTTTAAAAGTAAAAAAATACGGTCGACTGCGATCTACCAATACTTCTCGCCTGAT



Output:

>gi|28422838|gb|CB252000.1|CB252000 2003_EST00001 Human HIV associated B-cell immunoblastic lymphoma Homo sapiens cDNA clone hss2-1-6-7, mRNA sequence
--TGTGGTCTTCTTTCATTGACGCTCATCAGGGTGGGGAGTGA-----------------
----------TATATGTTGAC------------------TGGAGAGTCTAAAATACAACG
GACCACTACAATCT--CTCGGATATTCCACGTCGGT
>gi|28422842|gb|CB252002.1|CB252002 2003_EST00003 Human HIV associated B-cell immunoblastic lymphoma Homo sapiens cDNA clone hss2-2-9-5, mRNA sequence
CTGGTAGTCTTC------------------GGGAGAGGCTTGAGAG--------------
----------TGTCTACTCACCCC---------TTCCCCTAAAAAA--AAAAAAAAACTG
GTTGNCTCGGCCCTNACCCAGCTATCCAC-------
>gi|13779443|gb|BG644331.1|BG644331 EST00006 Human HIV associated B-cell centroblastic lymphoma Homo sapiens cDNA clone hss1-332 5' similar to B cell centroblastic lymphoma, HIV-associated, mRNA sequence
--GACAGC----------------------GGCTGAGGAGGGGAAGAGAGTNCTAAATGA
TAACAGTCTTTATCCGTTAACGCTGAATAAATGCCTTTTTTAAAAG--TAAAAAAATACG
GTCGACTGCGATCT--ACCAATACTTCTCGCCTGAT